pldB

Information for pldB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4006046-4006462 - CDS yigK EG11469 orf; hypothetical protein 4006776-4007798 + CDS pldB EG10739 lysophospholipase L(2) 4007918-4008433 + CDS yigL EG11470 orf; hypothetical protein

Reported regulatory sites for pldB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.072 4006687-4006703 gtcta TTTTTGTGCCACAATAC gctac - 0 - 3.265 4006592-4006614 tgttg ATTGCACCAGAGCCTGGCGACAG gctta - 0 - 2.027 4006635-4006651 tgtca GCAGGTAGGCAAACCAC cattc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back