plsB

Information for plsB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4250595-4251467 + CDS ubiA EG11370 4-hydroxybenzoate-octaprenyltransferase 4251622-4254105 - CDS plsB EG10740 glycerol-3-phosphate acyltransferase 4254216-4254584 + CDS dgkA EG10224 diacylglycerol kinase

Reported regulatory sites for plsB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.167 4254188-4254208 R aaaga ACCTTTTTACATTATGAGCGT caata - 0 - 2.297 4254132-4254148 R gtttg CGTAGCGCCGCGCGAAA catga - 0 - 1.997 4254141-4254162 R atccg ATGATTCGGGTTTGCGTAGCGC cgcgc - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back