plsC

Information for plsC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3159273-3160685 - CDS sufI EG11376 suppressor of ftsI 3160760-3161497 - CDS plsC EG11377 1-acyl-sn-glycerol-3-phosphate acyltransferase 3161731-3163989 - CDS parC EG10686 DNA topoisomerase IV subunit A

Reported regulatory sites for plsC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.800 3161572-3161595 R ttgcg ATTAACAATACGCTTTTCCAGAGA gcggc - 0 - 1.800 3161543-3161566 R gcggc TTTTAACAATGCCCTAACCTGATT tcagg - 0 - 1.748 3161504-3161520 R ccagt CTCTCAGACCTTCAGAG ggtgt - 0 - 1.257 3161610-3161632 R gataa AAATTCCCTTGAAACCGTTGTTT attca - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back