pncB

Information for pncB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 986808-988208 - CDS asnS EG10094 asparagine tRNA synthetase 988377-989579 - CDS pncB EG10742 nicotinate phosphoribosyltransferase 989845-992457 + CDS pepN EG10696 aminopeptidase N

Reported regulatory sites for pncB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.817 989717-989739 R ttatt GCTACATTTTTATAACATACACC gcgta - 0 - 2.513 989663-989685 R gcata TGGTGTGATCGGGGTTCAATAAA ttgcg - 0 - 2.087 989609-989626 R gaaga TGTTTATTGTACTAAACG ctcct - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back