pnp

Information for pnp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3305681-3306565 - CDS yhbM EG12371 putative control proteins 3306674-3308878 - CDS pnp EG10743 polynucleotide phosphorylase; cytidylate kinase activity 3309056-3309325 - CDS rpsO EG10914 30S ribosomal subunit protein S15

Reported regulatory sites for pnp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.194 3309015-3309038 R tcaga AAAGGGGGCCTGAGTGGCCCCTTT tttca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.803 3308941-3308961 R tgaat GATCTTCCGTTGCAGAGGTTC gcgcg - 0 - 4.517 3308916-3308936 R cgcgc GGCTAATGAGAGGCTTTACCC acata - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back