polB

Information for polB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 60358-63264 - CDS hepA EG11083 probable ATP-dependent RNA helicase 63429-65780 - CDS polB EG10747 DNA polymerase II 65855-66550 - CDS araD EG10055 L-ribulose-5-phosphate 4-epimerase

Reported regulatory sites for polB: Genome coordinates Source Transcription factor Transcription factor annotation 65834-65853 DPInteract lexA regulator for SOS(lexA) regulon

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.551 65832-65855 R cagta ATGACTGTATAAAACCACAGCCAA tcaaa lexA 20 - 1.054 65801-65821 R cgaaa CCAGGCTATACTCAAGCCTGG ttttt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back