potF

Information for potF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 892180-892656 + CDS ybjN EG13683 putative sensory transduction regulator 893007-894119 + CDS potF EG11629 periplasmic putrescine-binding protein; permease protein 894133-895347 + CDS potG EG11630 ATP-binding component of putrescine transport system

Reported regulatory sites for potF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.759 892793-892815 tgcat AAAAATTTGTTAAATACCGTTTT ttaat - 0 - 3.759 892836-892858 gtctc AAACCCTGGCTAAAGTTATTCTT gcgat - 0 - 2.213 892720-892742 ctgtt TTTAACCTTTTCTTAAAGATTAT ttcac - 0 - 2.213 892762-892784 gtcga TTTGGCTTTATCACATAGAGCAA atatg - 0 - 1.794 892923-892946 cgccg ATAAAAAATATGCACGTTTATTGC atatc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back