poxB

Information for poxB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 907516-908517 - CDS ybjU EG13690 putative arylsulfatase 908554-910272 - CDS poxB EG10754 pyruvate oxidase 910405-911373 - CDS b0872 EG13691 putative enzyme

Reported regulatory sites for poxB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.822 910371-910394 R ttatg CCCGATGATATTCCTTTCATCGGG ctatt - 0 REPt84 (24) - 3.458 910289-910311 R gaact AAACTTGTTACCGTTATCACATT cagga - 0 - 0.167 910350-910373 R tcatc GGGCTATTTAACCGTTAGTGCCTC ctttc - 0 REPt84 (4)

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back