ppa

Information for ppa, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4446269-4446619 + CDS chpB EG12096 probable growth inhibitor; PemK-like; autoregulated 4446699-4447229 - CDS ppa EG10755 inorganic pyrophosphatase 4447539-4448495 + CDS ytfQ EG12517 putative LACI-type transcriptional regulator

Reported regulatory sites for ppa: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.322 4447262-4447284 R ggcgc GAGTTGGCTATAATACTCGGCAC ttgtt - 0 - 2.390 4447286-4447303 R aaaac AAGCGAAGACATTCGGCG cgagt - 0 - 0.976 4447434-4447453 R ttgcg TTACATCACACTTCAAAAAA gtaaa - 0 - 0.976 4447380-4447399 R atcgc TTTCATCTCACTATGAAAAA tgcgg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back