ppdA

Information for ppdA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2961175-2961738 - CDS ppdB EG11156 prepilin peptidase dependent protein B 2961729-2962199 - CDS ppdA EG12081 prepilin peptidase dependent protein A 2962383-2963177 - CDS thyA EG11002 thymidylate synthetase

Reported regulatory sites for ppdA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.458 2962281-2962296 R aaatt TTGCAACGTCCTGCAA cggcg - 0 - 3.100 2962291-2962307 R acgcc TTCCCGAAATTTTGCAA cgtcc - 0 - 0.000 2962342-2962361 R cagag CCGACGCCAGTGTGCGTCGG ttttt - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back