ppdD

Information for ppdD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 115714-117099 - CDS hofB EG12106 putative integral membrane protein involved in biogenesis of fimbriae; protein transport; DNA uptake 117109-117549 - CDS ppdD EG12107 prelipin peptidase dependent protein 117752-118645 - CDS nadC EG11546 quinolinate phosphoribosyltransferase

Reported regulatory sites for ppdD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.133 117674-117697 R ccaac TTTCTTCGTAACGCCTCGCAAATT tcttg - 0 - 0.950 117651-117666 R ttgtc TTTCGCTGCAACGAAA taaaa - 0 - 0.852 117573-117589 R tggcg TTTGCCAAAGTAGCGCC aacca - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back