pphA

Information for pphA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1920061-1920336 + CDS b1837 EG14025 orf; hypothetical protein 1920337-1920996 - CDS pphA EG14026 protein phosphatase 1 modulates phosphoproteins; signals protein misfolding 1921389-1921730 - CDS b1839 EG14027 orf; hypothetical protein

Reported regulatory sites for pphA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.026 1921197-1921220 R gcaac TAAGCCTGCATTAATGCCAACTTT tagcg - 0 - 1.026 1921066-1921089 R acttt ATAGTCAACCATAACACACACTCT actgt - 0 - 0.769 1921034-1921053 R gagtc CAGCGTTTTTTAACATTCTT gttaa - 0 - 0.000 1921262-1921281 R attga CCATTTTGCACGCAAACTGG aaaac - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back