pphB

Information for pphB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2855116-2857677 + CDS mutS EG10625 methyl-directed mismatch repair 2857783-2858439 + CDS pphB EG13102 protein phosphatase 2 2858490-2859287 - CDS ygbI EG13103 putative DEOR-type transcriptional regulator

Reported regulatory sites for pphB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.578 2857748-2857771 accct GTATAATAGGAAAGCTTATTTTAC agggt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back