ppiB

Information for ppiB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 552441-553163 - CDS ybbF EG12666 orf; hypothetical protein 553166-553660 - CDS ppiB EG10758 peptidyl-prolyl cis-trans isomerase B (rotamase B) 553834-555219 + CDS cysS EG10196 cysteine tRNA synthetase

Reported regulatory sites for ppiB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.871 553780-553800 R aattg AGTTGCGTATAATACCCATAT ttccc - 0 - 1.871 553714-553734 R gtgcg GTTATGCTATAACACCACCCT atata - 0 - 0.982 553804-553827 R gaaga TTCCGTTTAGACATGTGTGGGTAA ttgag - 0 - 0.322 553747-553767 R gcgaa TCAGCATACATTGCGTGATGA tccga - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back