ppk

Information for ppk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2620254-2620892 + CDS purN EG10799 phosphoribosylglycinamide formyltransferase 1 2621064-2623130 + CDS ppk EG11510 polyphosphate kinase 2623135-2624676 + CDS ppx EG11403 exopolyphosphatase

Reported regulatory sites for ppk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.772 2620908-2620931 attaa AGCGCCAGCTCTGCCGCTGGCGTT tttca - 0 - 1.255 2621011-2621032 tattg CTCGCCATAATATCCAGGCAGT gtccc - 0 - 1.109 2620932-2620948 gcgtt TTTCAATTCACCTGTAA atcgc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back