pqiA

Information for pqiA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1009187-1011094 + CDS uup EG13134 putative ATP-binding component of a transport system 1011224-1012477 + CDS pqiA EG12965 paraquat-inducible protein A 1012482-1014122 + CDS pqiB EG12966 paraquat-inducible protein B

Reported regulatory sites for pqiA: Genome coordinates Source Transcription factor Transcription factor annotation 1010833-1010867 DPInteract soxS regulation of superoxide response regulon

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.318 1011146-1011162 tgcct GATGAACTGGGTTTATC aggca - 0 REPv87 (17) 0.252 1011170-1011192 gcatg AAAACCAACACTTTGTTAGTCAT ctgta - 0 REPv87 (1) 0.113 1011119-1011138 aacag AGACAGCTGACAACGGTAAA attgc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back