prfB

Information for prfB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3031677-3033194 - CDS lysS EG10552 lysine tRNA synthetase; constitutive; suppressor of ColE1 mutation in primer RNA 3033204-3034302 - CDS prfB EG10762 peptide chain release factor RF-2 3034393-3036126 - CDS recJ EG10830 ssDNA exonuclease; 5' --> 3' specific

Reported regulatory sites for prfB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.112 3034303-3034325 R tgact AGCTCAATAAAAGAAATCAGACC atgtt - 0 - 0.511 3034332-3034354 R ggtac AATCCCGCTCTTATCACCGCATT ttgac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back