proP

Information for proP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4326971-4327816 + CDS yjcZ EG12460 orf; hypothetical protein 4328080-4329582 + CDS proP EG11612 low-affinity transport system; proline permease II 4329759-4330850 - CDS basS EG11614 sensor protein for basR

Reported regulatory sites for proP: Genome coordinates Source Transcription factor Transcription factor annotation 4327848-4327875 PMID: 9079929 & RegulonDB crp cyclic AMP receptor protein 4327893-4327913 PMID: 7545153 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription 4327933-4327955 PMID: 7545153 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.026 4327853-4327874 aatcc ATGTGTGAAGTTGATCACAAAT ttaaa crp 22 - 3.969 4327874-4327896 acaaa TTTAAACACTGGTAGGGTAAAAA ggtca fis crp 4 2 - 3.732 4327894-4327914 ggtaa AAAGGTCATTAACTGCCCAAT tcagg fis 20 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back