prpR

Information for prpR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 345708-345983 + CDS yahO EG13599 orf; hypothetical protein 346081-347667 - CDS prpR EG13600 regulator for prp operon 347906-348796 + CDS prpB EG13601 putative phosphonomutase 2

Reported regulatory sites for prpR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.572 347745-347768 R tatgc GTTTCAGTTAACGTTTCAGGCAAT gtttc - 0 - 4.572 347711-347734 R accgc GTTTCATTGCAACAATTATGAAAC aagac - 0 - 2.181 347858-347879 R ttgtt ATTTGCGTTGATAAAGACAAAG caagg - 0 - 2.181 347821-347842 R gccac AATTGCCTTAATAAAATTAAAT gttta - 0 - 1.230 347688-347703 R gacta AACCCAATATTCGGTT tctta - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back