pta

Information for pta, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2411490-2412692 + CDS ackA EG10027 acetate kinase 2412767-2414911 + CDS pta EG20173 phosphotransacetylase 2415080-2416621 + CDS yfcC EG12607 putative S-transferase

Reported regulatory sites for pta: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.639 2412698-2412720 tttca CACCGCCAGCTCAGCTGGCGGTG ctgtt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.814 2412714-2412737 cagct GGCGGTGCTGTTTTGTAACCCGCC aaatc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back