ptsH

Information for ptsH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2530429-2531400 + CDS cysK EG10192 cysteine synthase A; O-acetylserine sulfhydrolase A 2531784-2532041 + CDS ptsH EG10788 PTS system protein HPr 2532086-2533813 + CDS ptsI EG10789 PEP-protein phosphotransferase system enzyme I

Reported regulatory sites for ptsH: Genome coordinates Source Transcription factor Transcription factor annotation 2531447-2531468 DPInteract crp cyclic AMP receptor protein 2531575-2531596 DPInteract crp cyclic AMP receptor protein 2531565-2531580 DPInteract fruR transcriptional repressor of fru operon and others 2531522-2531544 PMID: 10411743 mlc putative NAGC-like transcriptional regulator

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.484 2531425-2531448 cgtaa AAAAGCACCTTTTTAGGTGCTTTT ttgtg crp 2 - 5.859 2531522-2531545 gacta ATTATTTTGATGCGCGAAATTAAT cgtta mlc 23 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.765 2531715-2531731 aatac AGGCTAAAGTCGAACCG ccagg - 0 - 3.765 2531734-2531750 ccgcc AGGCTAGACTTTAGTTC cacaa - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back