pyrC

Information for pyrC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1120465-1120710 - CDS dinI EG12670 damage-inducible protein I 1120784-1121830 - CDS pyrC EG10806 dihydro-orotase 1121936-1122496 - CDS yceB EG11117 orf; hypothetical protein

Reported regulatory sites for pyrC: Genome coordinates Source Transcription factor Transcription factor annotation 1121877-1121902 DPInteract purR transcriptional repressor for pur regulon glyA glnB prsA speA

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.938 1121912-1121931 R atcac GAGGGCGCATTCGCGCCCTT tattt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.413 1121859-1121875 R tatcc TTTGTGTCCGGCAAAAA catcc - 0 - 2.828 1121879-1121900 R tcgtg CAAAGGAAAACGTTTCCGCTTA tcctt purR 22 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back