pyrG

Information for pyrG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2904665-2905963 - CDS eno EG10258 enolase 2906051-2907688 - CDS pyrG EG10810 CTP synthetase 2907916-2908707 - CDS mazG EG10572 orf; hypothetical protein

Reported regulatory sites for pyrG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.786 2907692-2907711 R ctttt CAACCTAACTTCTCAGGTTC agcat - 0 - 3.496 2907733-2907754 R catgt TCGGGTATACTGCTTTCCCGTC ttggt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.898 2907869-2907889 R cattt GTGTCATTTTTTAAATGACAA gcgct - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back