qor

Information for qor, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4260209-4260661 + CDS yjbO EG11933 orf; hypothetical protein 4260827-4261810 - CDS qor EG11492 quinone oxidoreductase 4261893-4263308 + CDS dnaB EG10236 replicative DNA helicase; part of primosome

Reported regulatory sites for qor: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.970 4261877-4261892 R gccat AGTGAATGGAGTTACC gagat - 0 - 1.567 4261860-4261876 R ttacc GAGATAAAGAATGGGTC gaaac - 0 - 1.255 4261845-4261864 R agaat GGGTCGAAACTTTATCATAT gaagc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back