rbsD

Information for rbsD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3928943-3930502 + CDS kup EG11541 low affinity potassium transport system 3930941-3931396 + CDS rbsD EG10817 D-ribose high-affinity transport system; membrane-associated protein 3931404-3932909 + CDS rbsA EG10814 ATP-binding component of D-ribose high-affinity transport system

Reported regulatory sites for rbsD: Genome coordinates Source Transcription factor Transcription factor annotation 3930951-3930965 PMID: 1304369 rbsR regulator for rbs operon

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.925 3930895-3930912 cacat TTCCGTAACGTCACGATG gtttt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.003 3930631-3930652 tgccg GATGATGGAAACCTCCTTCTTT atgtc - 0 - 3.528 3930594-3930616 agaag TTTTCCACCGCTGCGGTCTGGAA ggatt - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back