rcsA

Information for rcsA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2020915-2021700 + CDS fliR EG11977 flagellar biosynthesis 2021990-2022613 + CDS rcsA EG10820 positive regulator for ctr capsule biosynthesis; positive transcription factor 2022657-2022845 - CDS dsrB EG12636 orf; hypothetical protein

Reported regulatory sites for rcsA: Genome coordinates Source Transcription factor Transcription factor annotation 2021716-2021749 PMID: 10702265 rcsAB positive response regulator for colanic capsule biosynthesis (sensor RcsC)

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.479 2021962-2021984 gaatt ATCGTTACGCATTGAGTGAGGGT atgcc - 0 - 4.009 2021714-2021735 cgttt ATCATGTTATCCTAAGGATTAT ccgaa rcsAB 20 - 4.009 2021817-2021838 gcaac ATTTACTTTACTTTAAGACAAT tccag - 0 - 3.902 2021944-2021960 gaaat ATTCAGGTAAGGGGAAT tatcg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back