rcsF

Information for rcsF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 218887-219594 - CDS yaeB EG11503 orf; hypothetical protein 219591-219995 - CDS rcsF EG11502 regulator in colanic acid synthesis; interacts with RcsB 220113-220928 - CDS yaeC EG11504 putative lipoprotein

Reported regulatory sites for rcsF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 9.778 220055-220078 R tcatt CAGGACGGGCGCTTGCCCGTCTTG tcatt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.845 220029-220052 R ttgtc ATTTTTACAAGCTCCTGATTCAAT attga - 0 - 3.799 220084-220102 R aggct GTTTCCACAATTTGTAATA tcatt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back