rfaH

Information for rfaH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4021585-4021926 + CDS yigW_2 EG11481 orf; hypothetical protein 4021923-4022411 - CDS rfaH EG10839 transcriptional activator affecting biosynthesis of lipopolysaccharide core; F pilin; and haemolysin 4022578-4024071 + CDS yigC EG11396 putative oxidoreductase

Reported regulatory sites for rfaH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.185 4022525-4022544 R cggcg TTCATCTTTGCGATGCTGTA aattt - 0 - 2.733 4022505-4022523 R tgtaa ATTTGTTAAATTAGCGTGA actct - 0 - 2.733 4022457-4022475 R gggaa TATAATTAACTTAGCGTAA agctt - 0 - 2.451 4022539-4022555 R cgccc ATTATACGGCGTTCATC tttgc - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back