rfaQ

Information for rfaQ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3803570-3804694 - CDS rfaG EG11339 glucosyltransferase I; lipopolysaccharide core biosynthesis 3804691-3805725 - CDS rfaQ EG11341 lipopolysaccharide core biosynthesis 3806167-3807444 + CDS kdtA EG10520 3-deoxy-D-manno-octulosonic-acid transferase (KDO transferase)

Reported regulatory sites for rfaQ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.388 3805744-3805760 R gctag TGGAAAAGCCATTTCGA aaaat - 0 - 2.340 3806120-3806142 R gatgt GCTGGGGATTCTATGTATTTAGC tgtgg - 0 - 2.340 3805812-3805834 R aggta GCTGTTGAGCCTGGGGCGGTAGC gtgct - 0 - 2.062 3805885-3805907 R aaatc ATTCGGGTCGGATTGCTGCGAAA gaaat - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back