rfbA

Information for rfbA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2107603-2108160 - CDS rfbC EG11979 dTDP-6-deoxy-D-glucose-3;5 epimerase 2108160-2109041 - CDS rfbA EG11978 glucose-1-phosphate thymidylyltransferase 2109099-2109998 - CDS rfbD EG12411 dTDP-6-deoxy-L-mannose-dehydrogenase

Reported regulatory sites for rfbA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.073 2109046-2109065 R gagca AGATGAATTAAAAGGAATGA tgaaa - 0 - 1.068 2109073-2109090 R ttttt GCATCTTGTTCGTGATGG tggag - 0 - 0.366 2109058-2109080 R ttgtt CGTGATGGTGGAGCAAGATGAAT taaaa - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back