rhaB

Information for rhaB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4092304-4093563 - CDS rhaA EG11867 L-rhamnose isomerase 4093560-4095029 - CDS rhaB EG11868 rhamnulokinase 4095317-4096153 + CDS rhaS EG10843 positive regulator for rhaBAD operon

Reported regulatory sites for rhaB: Genome coordinates Source Transcription factor Transcription factor annotation 4095135-4095156 DPInteract crp cyclic AMP receptor protein 4095085-4095134 DPInteract rhaS positive regulator for rhaBAD operon

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.132 4095088-4095106 R ccatt TTCCTGTCAGTAACGAGAA ggtcg rhaS 19 - 3.591 4095134-4095157 R tcagc AAATTGTGAACATCATCACGTTCA tcttt crp rhaS 22 1 - 3.541 4095242-4095260 R ttctt ACCTTAAATTTTCGACGGA aaacc rhaR 19 - 3.541 4095210-4095228 R taaaa AACGTCGATTTTTCAAGAT acagc rhaR 19 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back