rhaS

Information for rhaS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4093560-4095029 - CDS rhaB EG11868 rhamnulokinase 4095317-4096153 + CDS rhaS EG10843 positive regulator for rhaBAD operon 4096137-4097075 + CDS rhaR EG10842 positive regulator for rhaRS operon

Reported regulatory sites for rhaS: Genome coordinates Source Transcription factor Transcription factor annotation 4095170-4095191 PMID: 11073923 crp cyclic AMP receptor protein 4095206-4095263 PMID: 2405166 & RegulonDB rhaR positive regulator for rhaRS operon

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.386 4095088-4095106 cgacc TTCTCGTTACTGACAGGAA aatgg rhaS 19 - 4.321 4095210-4095228 gctgt ATCTTGAAAAATCGACGTT tttta rhaR 19 - 4.321 4095242-4095260 ggttt TCCGTCGAAAATTTAAGGT aagaa rhaR 19 - 4.017 4095134-4095157 aaaga TGAACGTGATGATGTTCACAATTT gctga crp rhaS 22 1 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back