rhaT

Information for rhaT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4096137-4097075 + CDS rhaR EG10842 positive regulator for rhaRS operon 4097072-4098106 - CDS rhaT EG11313 rhamnose transport 4098391-4099011 + CDS sodA EG10953 superoxide dismutase; manganese

Reported regulatory sites for rhaT: Genome coordinates Source Transcription factor Transcription factor annotation 4098180-4098229 DPInteract rhaS positive regulator for rhaBAD operon 4098230-4098251 RegulonDB crp cyclic AMP receptor protein

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.417 4098216-4098239 R aagca AATCACCCACTTAATGCCGTGATT gccag crp rhaS 10 14 - 2.777 4098306-4098323 R agtta ATTAAATGATATTGAAAA tgatt arcA soxS fur 18 6 15 - 1.395 4098153-4098173 R taatc GACAGCACGATTTTTACACTC atctc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back