rhlB

Information for rhlB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3960360-3961844 - CDS gppA EG10413 guanosine pentaphosphatase; exopolyphosphatase 3961980-3963245 - CDS rhlB EG10844 putative ATP-dependent RNA helicase 3963322-3963705 + CDS trxA EG11031 thioredoxin 1

Reported regulatory sites for rhlB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.451 3963266-3963288 R ccgga TACGCTTTCGTAAAGCAATAGTA agctg - 0 - 4.575 3963292-3963308 R taaag GTTGACTTTATTTCACC ggata - 0 - 4.575 3963248-3963264 R agtaa GCTGATATTCTACCACA ctatg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back