rimJ

Information for rimJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1123341-1124579 - CDS yceL EG13878 orf; hypothetical protein 1124785-1125369 + CDS rimJ EG10851 acetylation of N-terminal alanine of 30S ribosomal subunit protein S5 1125380-1126027 + CDS yceH EG11537 orf; hypothetical protein

Reported regulatory sites for rimJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.702 1124622-1124640 cttcg GGGACAATATTTTTTTATC aaaac - 0 - 2.940 1124651-1124673 gtcgc TTTGATAGAGAGTTTTTATCAAA tatgt - 0 - 2.683 1124710-1124733 acttt TCACAGGGTCTGGTTGCGCAGGTA tagta - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back