rimK

Information for rimK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 890407-891129 + CDS mdaA EG11261 modulator of drug activity A 891190-892092 + CDS rimK EG10852 ribosomal protein S6 modification protein 892180-892656 + CDS ybjN EG13683 putative sensory transduction regulator

Reported regulatory sites for rimK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.210 891139-891159 gccac GTCGATGTATGATACGCGGGC ttttg - 0 -

Critical MAP values: p=0.01 4.76 p=0.05 3.70 p=0.1 3.23 p=0.2 2.71

Click here to go back