rna

Information for rna, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 642780-643190 - CDS rnk EG12637 regulator of nucleoside diphosphate kinase 643420-644226 - CDS rna EG10856 RNase I; cleaves phosphodiester bond between any two nucleotides 644340-645803 - CDS ybdS EG13538 putative a membrane protein

Reported regulatory sites for rna: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.699 644281-644304 R cgccc GCCAGGTAAGCCCACCTGGCGGGC ttttt - 0 - 3.273 644264-644280 R cgggc TTTTTTATGATTTAATA gatag - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back