rnb

Information for rnb, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1342781-1344766 - CDS yciR EG13415 orf; hypothetical protein 1345002-1346936 - CDS rnb EG11620 RNase II; mRNA degradation 1347004-1348209 - CDS yciW EG14262 putative oxidoreductase

Reported regulatory sites for rnb: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.380 1346969-1346990 R cgtca GACAGATTCGCGTAAAACTGTC agccg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.046 1346942-1346962 R gccgc TCTAATGGCCACCAAAATAGA caatt - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back