rnc

Information for rnc, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2700501-2701406 - CDS era EG10270 GTP-binding protein 2701403-2702083 - CDS rnc EG10857 RNase III; ds RNA 2702355-2703329 - CDS lepB EG10530 leader peptidase (signal peptidase I)

Reported regulatory sites for rnc: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.836 2702185-2702208 R acggc ACACGAAACAGCGTTGGTCCCCAT atacc - 0 - 2.836 2702119-2702142 R gaacc ATGTATATCAGGTCTGTTTCGTGT gctga - 0 - 2.178 2702315-2702337 R ttcac GTTGTCGCCGTTATGGCGACAAC gtgaa - 0 - 2.178 2702211-2702233 R ttaag GTTGGCACCTCCAGGTTGCCACG gcaca - 0 - 1.794 2702291-2702312 R aacgt GAATTATTTATGAGATAAATCT cccgt - 0 - 1.794 2702247-2702268 R ccccc GTCGTTGTGTATAGAATATTCC cccga - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back