rnd

Information for rnd, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1883869-1884834 + CDS yeaX EG13510 putative diogenase beta subunit 1884888-1886015 - CDS rnd EG10858 RNase D; processes tRNA precursor 1886085-1887770 - CDS fadD EG11530 acyl-CoA synthetase; long-chain-fatty-acid--CoA ligase

Reported regulatory sites for rnd: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.895 1886046-1886067 R tcgtc AGACGCCGGTTAATCCGGCGTT ttttt - 0 - 1.662 1886026-1886045 R gcgtt TTTTTTGACGCCCACTAAAG agaaa - 0 - 0.130 1886069-1886087 R aagcc TGAGCGTTAAGTCAGTCGT cagac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back