rnk

Information for rnk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 642630-643091 + CDS b0609 - orf; hypothetical protein 642780-643190 - CDS rnk EG12637 regulator of nucleoside diphosphate kinase 643420-644226 - CDS rna EG10856 RNase I; cleaves phosphodiester bond between any two nucleotides

Reported regulatory sites for rnk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.278 643246-643269 R taaac CCTCGCCGCCTGACGGTGAGGGTT ttctt - 0 - 2.338 643273-643293 R aacag TCAGTATCATCATGTGAGTTA aaccc - 0 - 1.963 643326-643347 R gcgct GCATTGAGGAATTCCCTGAATG tgacg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back