rob

Information for rob, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4631366-4632013 + CDS gpmB EG12164 phosphoglyceromutase 2 4632010-4632879 - CDS rob EG11366 right origin-binding protein 4633090-4633563 + CDS creA EG11217 orf; hypothetical protein

Reported regulatory sites for rob: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.890 4632886-4632909 R tcagg TGCTCGTTGTTGAAAGGATGAGGA tattt - 0 - 2.264 4632928-4632943 R acagc AAAAAATGCTATTATC caatt - 0 - 1.897 4632952-4632968 R taaga AAAAAACACTGAATGCT aaaac - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back