rph

Information for rph, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3812754-3813395 - CDS pyrE EG10808 orotate phosphoribosyltransferase 3813490-3814176 - CDS rph EG10863 RNase PH 3814303-3815166 + CDS yicC EG11192 putative alpha helix protein

Reported regulatory sites for rph: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.830 3814276-3814299 R ataga CGTTCCTGTTTATAAAAGGAGAGG tggaa - 0 - 1.808 3814177-3814198 R cattt GTTTCAAGCCGGAGATTTCAAT atgcg - 0 - 1.778 3814248-3814269 R ggaag GATTATAGCCATCGATGCCTTG tcagg - 0 - 1.778 3814225-3814246 R cttgt CAGGATAGGAATAACCGCCGGA agtcc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back