rpiA

Information for rpiA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3055198-3056430 - CDS serA EG10944 D-3-phosphoglycerate dehydrogenase 3056686-3057345 - CDS rpiA EG11443 ribosephosphate isomerase; constitutive 3057401-3057631 - CDS yqfE EG13163 orf; hypothetical protein

Reported regulatory sites for rpiA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.895 3057366-3057385 R ttgta TATAATGCGTGTGAAATTTC atacc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back