rplT

Information for rplT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1797250-1797294 - CDS pheM EG11272 phenylalanyl-tRNA synthetase (pheST) operon leader peptide 1797417-1797773 - CDS rplT EG10881 50S ribosomal subunit protein L20; and regulator 1797826-1798023 - CDS rpmI EG11231 50S ribosomal subunit protein A

Reported regulatory sites for rplT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.175 1797811-1797828 R acgca TAAGCCGTTAACGTTTTT aactt - 0 - 2.097 1797793-1797816 R ttaac GTTTTTAACTTTTTAATTAGAATA tagat - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back