rpmB

Information for rpmB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3808877-3809044 - CDS rpmG EG10891 50S ribosomal subunit protein L33 3809065-3809301 - CDS rpmB EG10886 50S ribosomal subunit protein L28 3809518-3810192 - CDS radC EG11312 DNA repair protein

Reported regulatory sites for rpmB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.172 3809469-3809485 R ttgtc TGTTCGGGACTTGAGCA catcg - 0 - 4.660 3809403-3809426 R atctc GGGTTTGGCATTTGGGCCTGGCAA tcgag - 0 - 4.660 3809355-3809378 R tgcga TGACCGGGCTGTAAAGCCTGACGA ggcgc - 0 - 4.152 3809318-3809341 R taccc CATACGAAGCTCGAGCTAATTTGA ttttt - 0 - 3.604 3809434-3809452 R cagcg TATACTACGCCACCTTTGA gaatc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back