rpoN

Information for rpoN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3341585-3342310 + CDS yhbG EG11680 putative ATP-binding component of a transport system 3342358-3343791 + CDS rpoN EG10898 RNA polymerase; sigma(54 or 60) factor; nitrogen and fermentation regulation 3343814-3344101 + CDS yhbH EG11681 probable sigma-54 modulation protein

Reported regulatory sites for rpoN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.587 3342339-3342355 tagca GGAGAGTACGATTCTGA acatg - 0 - 1.755 3342309-3342332 actct GATAGGGTAGAAGTTTGCGACGTT ttagc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back