rpoS

Information for rpoS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2863124-2864488 + CDS b2740 EG13108 putative transport protein 2864582-2865574 - CDS rpoS EG10510 RNA polymerase; sigma S (sigma38) factor; synthesis of many growth phase related proteins 2865637-2866776 - CDS nlpD EG12111 lipoprotein

Reported regulatory sites for rpoS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.860 2865618-2865638 R gcgat AAATCGGCGGAACCAGGCTTT tgctt - 0 - 3.536 2865583-2865606 R aatgt TCCGTCAAGGGATCACGGGTAGGA gccac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back