rpsB

Information for rpsB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 188712-189506 - CDS map EG10570 methionine aminopeptidase 189874-190599 + CDS rpsB EG10901 30S ribosomal subunit protein S2 190857-191708 + CDS tsf EG11033 protein chain elongation factor EF-Ts

Reported regulatory sites for rpsB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.621 189788-189809 cgtat CGGCACATATTCCGGGGTGCCC tttgg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.329 189691-189707 cgacg TATTTGTGGTATAAAGC gcgcc - 0 - 3.329 189832-189848 gggat ACGTGGAGGCATAACCC caact - 0 - 2.139 189535-189552 gatac CGACAATATATATGTAAG tgccg - 0 - 2.139 189664-189681 cacag CGCCAACAATTATTGGTG tccac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back