rpsG

Information for rpsG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3469037-3471151 - CDS fusA EG10360 GTP-binding protein chain elongation factor EF-G 3471179-3471718 - CDS rpsG EG10906 30S ribosomal subunit protein S7; initiates assembly 3471815-3472189 - CDS rpsL EG10911 30S ribosomal subunit protein S12

Reported regulatory sites for rpsG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.016 3471785-3471804 R ctccg TTAAGTAAGGCCAAACGTTT taact - 0 - 5.016 3471739-3471758 R ctcgt AGAGTTTTGGACAATCCTGA attaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.239 3471720-3471736 R tgaat TAACAACGGAGTATTTC catgc - 0 - 2.891 3471762-3471782 R tttta ACTTAAATGTCAAACTAAACT cgtag - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back